Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU006581

Sigma-Aldrich

MISSION® esiRNA

targeting human SUFU

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCTTTGAGTTGACCTTTCGTCTGAAGAGAGAAACTGGGGAGTCTGCCCCACCAACATGGCCCGCAGAGTTAATGCAGGGCTTGGCACGATACGTGTTCCAGTCAGAGAACACCTTCTGCAGTGGGGACCATGTGTCCTGGCACAGCCCTTTGGATAACAGTGAGTCAAGAATTCAGCACATGCTGCTGACAGAGGACCCACAGATGCAGCCCGTGCAGACACCCTTTGGGGTAGTTACCTTCCTCCAGATCGTTGGTGTCTGCACTGAAGAGCTACACTCAGCCCAGCAGTGGAACGGGCAGGGCATCCTGGAGCTGCTGCGGACAGTGCCTATTGCTGGCGGCCCCTGGCTGATAACTGACATGCGGAGGGGAGAGACCATATTTGAGATCGATCCACACCTGCAAGAGAGAGTTGACAAAGGCATCGAGACAG

Numéro d'accès Ensembl | humain

ENSG00000107882

Numéro d'accès NCBI

NM_016169

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SUFU(51684) , SUFU(51684)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yin Peng et al.
Cell cycle (Georgetown, Tex.), 19(20), 2720-2733 (2020-10-06)
The poor prognosis of late gastric carcinomas (GC) underscores the necessity to identify novel biomarkers for earlier diagnosis and effective therapeutic targets. MiRNA-324-5p has been shown to be over-expressed in GC, however the biological function of miRNA-324-5p implicated in gastric
Yin Peng et al.
Cancer letters, 385, 117-127 (2016-11-05)
Emerging evidence has shown that miRNA-194 is aberrantly upregulated in gastric cancer (GC); however, the biological mechanisms underlying its involvement are largely unknown. Wnt/β-catenin signaling has been implicated in gastric tumorigenesis; we therefore hypothesized that miRNA-194 promotes gastric carcinogenesis by
Bo Ram Kim et al.
Cell death and differentiation, 27(2), 676-694 (2019-07-07)
Disabled tumor suppressor genes and hyperactive oncogenes greatly contribute to cell fates during cancer development because of their genetic alterations such as somatic mutations. However, little is known about how tumor suppressor genes react to diverse oncogenes during tumor progression.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique