Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU003471

Sigma-Aldrich

MISSION® esiRNA

targeting human SRF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACGACCTTCAGCAAGAGGAAGACGGGCATCATGAAGAAGGCCTATGAGCTGTCCACGCTGACAGGGACACAGGTGCTGTTGCTGGTGGCCAGTGAGACAGGCCATGTGTATACCTTTGCCACCCGAAAACTGCAGCCCATGATCACCAGTGAGACCGGCAAGGCACTGATTCAGACCTGCCTCAACTCGCCAGACTCTCCACCCCGTTCAGACCCCACAACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGACAGATCTCACCTACCAGGTGTCGGAGTCTGACAGCAGTGGGGAGACCAAGGACACACTGAAGCCGGCGTTCACAGTCACCAACCTGCCGGGTACAACCTCCACCATCCAAACAGCACCTAGCACCTCTACCACCATGCAAGTCAGCAGCGGCCCCTCCTTTCCCATCACCAACTACCTGGCACC

Numéro d'accès Ensembl | humain

ENSG00000112658

Numéro d'accès NCBI

NM_003131

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SRF(6722) , SRF(6722)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Carolina Leimgruber et al.
Journal of cellular physiology, 232(10), 2806-2817 (2016-11-20)
Prostatic smooth muscle cells (pSMCs) differentiation is a key factor for prostatic homeostasis, with androgens exerting multiple effects on these cells. Here, we demonstrated that the myodifferentiator complex Srf/Myocd is up-regulated by testosterone in a dose-dependent manner in primary cultures
Xi He et al.
Oncology letters, 5(3), 819-824 (2013-02-22)
Recent studies indicate that serum response factor (SRF) is highly expressed in tumors such as hepatocellular, thyroid, esophageal and lung carcinoma. However, the expression and roles of SRF in esophageal squamous cell carcinoma (ESCC) are unclear. In this study, immunohistochemistry
Qi Li et al.
PloS one, 8(9), e75470-e75470 (2013-09-24)
Transcriptional regulation is essential for any gene expression including microRNA expression. MiR-1-1 and miR-133a-2 are essential microRNAs (miRs) involved in cardiac and skeletal muscle development and diseases. Early studies reveal two regulatory enhancers, an upstream and an intragenic, that direct
Min-Seok Kim et al.
Scientific reports, 9(1), 4631-4631 (2019-03-16)
Methylmercury is an environmental pollutant that causes specific and serious damage to the central nervous system. We have previously shown that C-C motif chemokine ligand 4 (CCL4) protects cultured neural cells from methylmercury toxicity and expression of CCL4 is specifically
Allen Sam Titus et al.
American journal of physiology. Heart and circulatory physiology, 318(6), H1538-H1558 (2020-05-16)
Relative resistance to apoptosis and the ability to proliferate and produce a collagen-rich scar determine the critical role of cardiac fibroblasts in wound healing and tissue remodeling following myocardial injury. Identification of cardiac fibroblast-specific factors and mechanisms underlying these aspects
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique