Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU002801

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGTGGACATCACCAGAAGCTATAGCCTACCGCAAGTTCACGTCAGCCAGCGATGTATGGAGTTATGGGATTGTTCTCTGGGAGGTGATGTCTTATGGAGAGAGACCATACTGGGAGATGTCCAATCAGGATGTAATTAAAGCTGTAGATGAGGGCTATCGACTGCCACCCCCCATGGACTGCCCAGCTGCCTTGTATCAGCTGATGCTGGACTGCTGGCAGAAAGACAGGAACAACAGACCCAAGTTTGAGCAGATTGTTAGTATTCTGGACAAGCTTATCCGGAATCCCGGCAGCCTGAAGATCATCACCAGTGCAGCCGCAAGGCCATCAAACCTTCTTCTGGACCAAAGCAATGTGGATATCACTACCTTCCGCACAACAGGTGACTGGCTTAATGGTGTCTGGACAGCACACTGCAAGGAAATCTTCACGGGTGTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Song Hee Kim et al.
Cellular signalling, 47, 122-130 (2018-04-14)
Radiotherapy is a well-established therapeutic modality used in the treatment of many cancers. However, radioresistance remains a serious obstacle to successful treatment. Radioresistance can cause local recurrence and distant metastases in some patients after radiation treatment. Thus, many studies have
Hemei Xiao et al.
Cell biology international (2018-04-17)
MicroRNAs (miRNAs) play key roles in cervical cancer metastasis progression. Accumulated evidences have revealed that miRNAs are related to the pathophysiological process. However, the role of miR-340 in cervical cancer and how it works is still not fully interpreted. Using
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM
Xiaole Chen et al.
Molecular cancer research : MCR, 16(5), 909-919 (2018-02-18)
The Hedgehog (Hh) receptor Patched1 (PTCH1) is a well-known tumor suppressor that in its active form represses Smoothened (SMO) activity, inhibits proliferation, and induces apoptosis. The cytoplasmic C-terminal domain (CTD) regulates PTCH1 turnover and nucleates a proapoptotic complex. In this

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique