Skip to Content
Merck
All Photos(1)

Key Documents

HMI2164

Sigma-Aldrich

MISSION® microRNA Mimic

hsa-miR-5684

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
12352200

product line

MISSION®

form

solid

mature sequence

AACUCUAGCCUGAGCAACAG

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

Gene Information

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

13 - Non Combustible Solids

WGK

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service