Skip to Content
Merck
All Photos(1)

Key Documents

EMU092631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rap1a

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Estimated to ship on07 April 2025



Select a Size

Change View
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

CHF 249.00


Estimated to ship on07 April 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACGGGTAGTTGGCAAAGAACAAGGCCAGAATTTAGCAAGACAGTGGTGTAACTGTGCCTTTTTAGAATCTTCTGCAAAGTCAAAGATCAACGTTAATGAGATATTTTATGACCTGGTCAGACAGATAAATAGAAAAACACCAGTGGAAAAGAAGAAGCCTAAAAAGAAATCATGTTTGCTGCTCTAGACCTGAAGTCAGCAGCAGCTCTGAGCCAGATTACAGAAATGAAGAACTGTTGCCTAATTGGAAAGTGCCAGCATTCCAGACTTCAAAAACGAAATCTGAAGAGGCTTCTCCTGTTTTATATATTATGTGAAGAATTTAGATCTTATATTGGTTTGCACAAGTTCCCTGGAGACAAAGTTGCTCTGTGTATATCTCTTGGAAATAAGACATAGTATTTCTCCTTTGCAATAGCAGTTATAACAGATGTGAAATAAGATACTTGACTCTAATACAATTATACAGAAGAGCATGGATGCATT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service