Skip to Content
Merck
All Photos(1)

Key Documents

EMU064131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Glul

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Select a Size

Change View
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGGAGAAGAAGGGCTACTTTGAAGACCGTCGGCCTTCTGCCAATTGTGACCCCTATGCGGTGACAGAAGCCATCGTCCGCACGTGTCTCCTCAACGAAACAGGCGACGAACCCTTCCAATACAAGAACTAAGTGGACTAGACTTCCAGTGATCCCTCTCCCAGCTCTTCCCTTTCCCAGTTGTCCCCACTGTAACTCAAAAGGATGGAATACCAAGGTCTTTTTATTCCTCGTGCCCAGTTAATCTTGCTTTTGTTGGTCAGAATAGAGGGGTCAGGTTCTTAATCTCTACACACCAACCCTTTCTTTCCTATCTAGCTTTCTAGTGGGGAGCGGGAGGGGGGAGGGGAAGGGTAACCCACTGCTTCATCTCATCGGGTATGCATGTCCGGTAGGCATAGCTGTCACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study
Vitaliy Marchenko et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 308(11), R916-R926 (2015-04-03)
While supraspinal mechanisms underlying respiratory pattern formation are well characterized, the contribution of spinal circuitry to the same remains poorly understood. In this study, we tested the hypothesis that intraspinal GABAergic circuits are involved in shaping phrenic motor output. To

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service