Skip to Content
Merck
All Photos(1)

Documents

EHU225481

Sigma-Aldrich

MISSION® esiRNA

targeting human IGHM

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCCTCGCACAGGACTTCCTTCCCGACTCCATCACTTTCTCCTGGAAATACAAGAACAACTCTGACATCAGCAGCACCCGGGGCTTCCCATCAGTCCTGAGAGGGGGCAAGTACGCAGCCACCTCACAGGTGCTGCTGCCTTCCAAGGACGTCATGCAGGGCACAGACGAACACGTGGTGTGCAAAGTCCAGCACCCCAACGGCAACAAAGAAAAGAACGTGCCTCTTCCAGTGATTGCCGAGCTGCCTCCCAAAGTGAGCGTCTTCGTCCCACCCCGCGACGGCTTCTTCGGCAACCCCCGCAAGTCCAAGCTCATCTGCCAGGCCACGGGTTTCAGTCCCCGGCAGATTCAGGTGTCCTGGCTGCGCGAGGGGAAGCAGGTGGGGTCTGGCGTCACCACGGACCAGGTGCAGGCTGAGGCCAAAGAGTCTGGGCCCACGACCTACAAGGTGACCAGCACACTGACCATCAAAGAGAGCGACTGGCTCAGCCAGAGCATGTTCACCTGC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGHM(3507)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ai Kawamoto-Hirano et al.
The Annals of otology, rhinology, and laryngology, 125(3), 219-227 (2015-09-24)
To clarify composite fibers and cells in the synovial tissues of the cricoarytenoid joint (CA joint). Routine histology and immunohistrochemistry using sagittal or nearly sagittal sections obtained from 18 elderly cadaveric specimens. The CA joint capsule was thin and contained
J Westra et al.
Clinical and experimental immunology, 178(1), 40-47 (2014-06-04)
Rituximab (RTX) treatment in rheumatoid arthritis (RA) patients severely hampers humoral response after influenza vaccination as determined by haemagglutination inhibition assay (HI). It is not known whether HI reflects both immunoglobulin (Ig)M and IgG (subclass) influenza response, and whether IgM
Elvira Bailón et al.
Journal of leukocyte biology, 96(2), 185-199 (2014-08-01)
This study addresses the role of (pro)MMP-9 overexpression in CLL cell migration. We have used primary CLL cells and CLL-derived MEC-1 cells transfected with empty (mock cells) or proMMP-9-encoding (MMP-9 cells) lentiviral vectors. The constitutive (pro)MMP-9 expression in mock cells
Willem J J Falkenburg et al.
Arthritis & rheumatology (Hoboken, N.J.), 67(12), 3124-3134 (2015-08-08)
To investigate the presence and patterns of specific IgG subclass recognition by IgM rheumatoid factor (IgM-RF) and IgA-RF with a newly developed enzyme-linked immunosorbent assay (ELISA), which can discriminate between polyspecific and restricted RF responses. Polyspecific and restricted RF responses
Elisabeth M Meulenbroek et al.
Haematologica, 100(11), 1407-1414 (2015-09-12)
In autoimmune hemolytic anemia autoantibodies against erythrocytes lead to increased clearance of the erythrocytes, which in turn results in a potentially fatal hemolytic anemia. Depending on whether IgG or IgM antibodies are involved, response to therapy is different. Proper identification

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service