Skip to Content
Merck
All Photos(1)

Key Documents

EHU121531

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGAGATCCGAAGGAATGAAATCCGGATGCTCATGAAGCAGCAGGACCGGCTGGAGGAGCGAGAGCAGGACATTGAGGACCAGCTGTACAAACTCGAGTCAGACAAGCGCCTGGTGGAGGAGAAAGTGAACCAACTGAAGGAGGAAGTTCGGCTGCAGTACGAGAAGCTGCACCAGCTGCTGGACGAGGACCTGCGGCAGACAGTGGAGGTCCTAGACAAGGCCCAGGCCAAGTTCTGCAGCGAGAACGCAGCGCAGGCGCTGCACCTCGGGGAGCGCATGCAGGAGGCCAAGAAGCTGCTGGGCTCCCTGCAGCTGCTCTTTGATAAGACGGAGGATGTCAGCTTCATGAAGAACACCAAGTCTGTGAAAATCCTGATGGACAGGACCCAGACCTGCACGAGCAGCAGCCTTTCCCCCACTAAGATCGGCCACCTGAACTCCAAGCTCTTCCTGAACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoyan Dang et al.
Cell transplantation, 29, 963689720949247-963689720949247 (2020-08-26)
Tripartite motif 8 (TRIM8) is a member of the TRIM protein family that has been found to be implicated in cardiovascular disease. However, the role of TRIM8 in myocardial ischemia/reperfusion (I/R) has not been investigated. We aimed to explore the
Litao Guo et al.
Inflammation, 40(2), 454-463 (2016-12-21)
Pseudomonas aeruginosa (PA)-induced keratitis is a rapidly progressive ocular infectious disease that often leads to inflammatory epithelial edema, stromal infiltration, tissue destruction, corneal ulceration, and vision loss. In this study, we investigate the role of tripartite motif 8 (TRIM8) in
Xue Bai et al.
Experimental cell research, 388(2), 111818-111818 (2020-01-10)
Stroke is a leading global cause of mortality and disability. However, the pathogenesis that contributes to stroke has not been fully understood. The tripartite motif (TRIM)-containing proteins usually exhibit essential regulatory roles during various biological processes. TRIM8 is a RING

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service