Skip to Content
Merck
All Photos(1)

Documents

EHU116671

Sigma-Aldrich

MISSION® esiRNA

targeting human CHKB, CHKB-CPT1B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAGCAAGGCCCACAGACTACCCCACTCAAGAACAGCAGTTGCATTTTATTCGTCATTACCTGGCAGAGGCAAAGAAAGGTGAGACCCTCTCCCAAGAGGAGCAGAGAAAACTGGAAGAAGATTTGCTGGTAGAAGTCAGTCGGTATGCTCTGGCATCCCATTTCTTCTGGGGTCTGTGGTCCATCCTCCAGGCATCCATGTCCACCATAGAATTTGGTTACTTGGACTATGCCCAGTCTCGGTTCCAGTTCTACTTCCAGCAGAAGGGGCAGCTGACCAGTGTCCACTCCTCATCCTGACTCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoyun Yang et al.
Life sciences, 106(1-2), 12-18 (2014-04-22)
The checkpoint kinase 1 (Chk1) functions not only in genotoxic stresses but also in normal cell cycle progression, particularly in the initiation, progression and fidelity of unperturbed mitosis. In this study, we investigated the role of Chk1 in regulating the
F Ye et al.
Cancer gene therapy, 21(5), 209-217 (2014-05-24)
Mammalian checkpoint kinases 1 and 2 (Chk1 and Chk2) are essential kinases that are involved in cell cycle checkpoint control, and the abrogation of either has been proposed as one way to sensitize cancer cells to DNA-damaging agents. However, it
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service