Skip to Content
Merck
All Photos(1)

Documents

EHU108481

Sigma-Aldrich

MISSION® esiRNA

targeting human RBMX

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACCACCACCAAGAAGTGGGGGTCCTCCTCCTAAGAGATCTGCACCTTCAGGACCAGTTCGCAGTAGCAGTGGAATGGGAGGAAGAGCTCCTGTATCACGTGGAAGAGATAGTTATGGAGGTCCACCTCGAAGGGAACCGCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGAGATGATGGGTATTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACTAGAGATTATGCACCACCACCACGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCACGTGATGACTATCCATCAAGAGGATATAGCGATAGAGATGGATATGGTCGTGATCGTGACTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATGGTAACTCACGTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nian Liu et al.
Nucleic acids research, 45(10), 6051-6063 (2017-03-24)
N6-methyladenosine (m6A) is the most abundant internal modification in eukaryotic messenger RNA (mRNA), and affects almost every stage of the mRNA life cycle. The YTH-domain proteins can specifically recognize m6A modification to control mRNA maturation, translation and decay. m6A can
Justin S Becker et al.
Molecular cell, 68(6), 1023-1037 (2017-12-23)
Heterochromatin is integral to cell identity maintenance by impeding the activation of genes for alternate cell fates. Heterochromatic regions are associated with histone 3 lysine 9 trimethylation (H3K9me3) or H3K27me3, but these modifications are also found in euchromatic regions that
Katherine I Zhou et al.
Molecular cell, 76(1), 70-81 (2019-08-26)
N6-methyladenosine (m6A) modification occurs co-transcriptionally and impacts pre-mRNA processing; however, the mechanism of co-transcriptional m6A-dependent alternative splicing regulation is still poorly understood. Heterogeneous nuclear ribonucleoprotein G (hnRNPG) is an m6A reader protein that binds RNA through RRM and Arg-Gly-Gly (RGG)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service