Skip to Content
Merck
All Photos(1)

Key Documents

EHU096281

Sigma-Aldrich

MISSION® esiRNA

targeting human ATXN1 (1)

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Select a Size

Change View
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGCACTTTGACTGCTCTGGAGTAGGGTTGTACAATTTCAAGGAATGTTTGGATTTCCTGCATCTTGTGGATTACTCCTTAGATACCGCATAGATTGCAATATAATGCTGCATGTTCAAGATGAACAGTAGCTCCTAGTAATCATAAAATCCACTCTTTGCACAGTTTGATCTTTACTGAAATATGTTGCCAAAATTTATTTTTGTTGTTGTAGCTCTGGATTTTGTTTTGTTTTGTTTTTTAAGGAAACGATTGACAATACCCTTTAACATCTGTGACTACTAAGGAAACCTATTTCTTTCATAGAGAGAAAAATCTCCAATGCTTTTGAAGACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

A-Ram Kang et al.
Oncotarget, 8(11), 18248-18259 (2017-02-18)
The mutant form of the protein ataxin-1 (ATXN1) causes the neurodegenerative disease spinocerebellar ataxia type-1. Recently, ATXN1 was reported to enhance E-cadherin expression in the breast cancer cell line MCF-7, suggesting a potential association between ATXN1 and cancer development. In
Yuka Sugihara et al.
PloS one, 14(5), e0217394-e0217394 (2019-05-29)
Recently, we showed that imidazole dipeptide such as carnosine contained abundantly in chicken breast meat improves brain function in a double-blind randomized controlled trial. However, the underlying molecular mechanisms remain unknown. Here, we investigated whether carnosine activates intestinal epithelial cells
Larissa Nitschke et al.
Genes & development, 34(17-18), 1147-1160 (2020-08-09)
Identifying modifiers of dosage-sensitive genes involved in neurodegenerative disorders is imperative to discover novel genetic risk factors and potential therapeutic entry points. In this study, we focus on Ataxin-1 (ATXN1), a dosage-sensitive gene involved in the neurodegenerative disease spinocerebellar ataxia

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service