Skip to Content
Merck
All Photos(1)

Key Documents

EHU067041

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Estimated to ship on25 April 2025



Select a Size

Change View
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

CHF 249.00


Estimated to ship on25 April 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGGATCCTACGGGACTTCTACTCACCACTGGTGCCTGACAGCATGAAATTTGAGATTGGAGAGGCTCTTTACTTGGGCATTATTTCTTCCCTGTTCTCCCTGATAGCTGGAATCATCCTCTGCTTTTCCTGCTCATCCCAGAGAAATCGCTCCAACTACTACGATGCCTACCAAGCCCAACCTCTTGCCACAAGGAGCTCTCCAAGGCCTGGTCAACCTCCCAAAGTCAAGAGTGAGTTCAATTCCTACAGCCTGACAGGGTATGTGTGAAGAACCAGGGGCCAGAGCTGGGGGGTGGCTGGGTCTGTGAAAAACAGTGGACAGCACCCCGAGGGCCACAGGTGAGGGACACTACCACTGGATCGTGTCAGAAGGTGCTGCTGAGGATAGACTGACTTTGGCCATTGGATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Christopher T Capaldo et al.
Molecular biology of the cell, 25(18), 2710-2719 (2014-07-18)
Tight junctions (TJs) are dynamic, multiprotein intercellular adhesive contacts that provide a vital barrier function in epithelial tissues. TJs are remodeled during physiological development and pathological mucosal inflammation, and differential expression of the claudin family of TJ proteins determines epithelial
Yong-guo Zhang et al.
PloS one, 8(3), e58606-e58606 (2013-03-19)
Tight junctions seal the space between adjacent epithelial cells. Mounting evidence suggests that tight junction proteins play a key role in the pathogenesis of human disease. Claudin is a member of the tight junction protein family, which has 24 members

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service