Skip to Content
Merck
All Photos(1)

Documents

EHU028791

Sigma-Aldrich

MISSION® esiRNA

targeting human PDK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGACCGCTTCTACCTCAGCCGCATCTCCATCCGCATGCTCATCAACCAGCACACCCTCATCTTTGATGGCAGCACCAACCCAGCCCATCCCAAACACATCGGCAGCATCGACCCCAACTGCAACGTCTCTGAGGTGGTCAAAGATGCCTACGACATGGCTAAGCTCCTGTGTGACAAGTATTACATGGCCTCACCTGACCTGGAGATCCAGGAGATCAATGCAGCCAACTCCAAACAGCCGATTCACATGGTCTACGTCCCCTCCCACCTCTACCACATGCTCTTTGAGCTCTTCAAGAATGCCATGAGGGCGACTGTGGAAAGCCATGAGTCCAGCCTCATTCTCCCACCCATCAAGGTCATGGTGGCCTTGGGTGAGGAAGATCTGTCCATCAAGATGAGTGACCGAGGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feifei Wei et al.
Cancer medicine, 9(7), 2480-2490 (2020-02-06)
Hepatocellular carcinoma (HCC) is one of the most deadly cancer worldwide. Multiple long noncoding RNAs (lncRNAs) are recently identified as crucial oncogenic factors or tumor suppressors. In this study, we explored the functon and mechanism of lncRNA double homeobox A
Yonggang Zhou et al.
Science translational medicine, 12(537) (2020-04-03)
Abundant decidual natural killer (dNK) cells at the maternal-fetal interface are important during early pregnancy. However, functional subsets of dNK cells remain poorly understood. We describe a CD49a+PBX homeobox 1 (PBX1)+ dNK cell subset that promotes fetal development in humans
Zhongyuan He et al.
Cell death & disease, 9(5), 505-505 (2018-05-05)
Increasing evidence indicates that dysregulation of microRNAs (miRNAs) plays a crucial role in human malignancies. Here, we showed that microRNA-422a (miR-422a) expression was dramatically downregulated in gastric cancer (GC) samples and cell lines compared with normal controls, and that its

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service