Skip to Content
Merck
All Photos(1)

Key Documents

EHU014831

Sigma-Aldrich

MISSION® esiRNA

targeting human BUB1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Estimated to ship on17 March 2025



Select a Size

Change View
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

CHF 249.00


Estimated to ship on17 March 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACCCAGTTGATGGAAAGACTAAAGCCATCTATGCAGCACATGTTTATGAAGTTCTATTCTGCCCACTTATTCCAGAATGGCAGTGTATTAGTAGGAGAGCTCTACAGCTATGGAACATTATTAAATGCCATTAACCTCTATAAAAATACCCCTGAAAAAGTGATGCCTCAAGGTCTTGTCATCTCTTTTGCTATGAGAATGCTTTACATGATTGAGCAAGTGCATGACTGTGAAATCATTCATGGAGACATTAAACCAGACAATTTCATACTTGGAAACGGGCAAGTATTTTTGGAACAGGATGATGAAGATGATTTATCTGCTGGCTTGGCACTGATTGACCTGGGTCAGAGTATAGATATGAAACTTTTTCCAAAAGGAACTATATTCACAGCAAAGTGTGAAACATCTGGTTTTCAGTGTGTTGAGATGCTCAGCAACAAACCATGGAACTACCAGATCGATTACTTTGGGGTTGCTGCAACAGTATATTGCATGCTCTTTGGCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mathijs Vleugel et al.
Journal of cell science, 128(16), 2975-2982 (2015-07-08)
Mitotic chromosome segregation is initiated by the anaphase promoting complex/cyclosome (APC/C) and its co-activator CDC20 (forming APC/C(CDC20)). APC/C(CDC20) is inhibited by the spindle assembly checkpoint (SAC) when chromosomes have not attached to spindle microtubules. Unattached kinetochores catalyze the formation of
Yutaka Matsubara et al.
Shock (Augusta, Ga.), 51(3), 364-371 (2018-04-03)
Severe sepsis is critical to health and can result in acute renal failure (ARF). Tissue factor (TF) and thrombomodulin (TM) play key roles in vascular endothelial functions by helping maintain microcirculation in the kidney. Budding uninhibited by benzimidazole-1 (Bub1) plays
Katharina Overlack et al.
Current biology : CB, 27(19), 2915-2927 (2017-09-26)
The spindle assembly checkpoint (SAC) prevents premature sister chromatid separation during mitosis. Phosphorylation of unattached kinetochores by the Mps1 kinase promotes recruitment of SAC machinery that catalyzes assembly of the SAC effector mitotic checkpoint complex (MCC). The SAC protein Bub3
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service