Skip to Content
Merck
All Photos(1)

Documents

EHU076701

Sigma-Aldrich

MISSION® esiRNA

targeting human TAZ

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACAAGTCGGCTGTGGAGATGCGGAAAGCCCTGACGGACTTCATTCAAGAGGAATTCCAGCATCTGAAGACTCAGGCAGAGCAGCTCCACAACCACCTCCAGCCTGGGAGATAGGCCTTGCTTGCTGCCTTCTGGATTCTTGGCCCGCACAGAGCTGGGGCTGAGGGATGGACTGATGCTTTTAGCTCAAACGTGGCTTTTAGACAGATTTGTTCATAGACCCTCTCAAGTGCCCTCTCCGAGCTGGTAGGCATTCCAGCTCCTCCGTGCTTCCTCAGTTACACAAAGGACCTCAGCTGCTTCTCCCACTTGGCCAAGCAGGGAGGAAGAAGCTTAGGCAGGGCTCTCTTTCCTTCTTGCCTTCAGATGTTCTCTCCCAGGGGCTGGCTTCAGGAGGGAGCATAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenguang Chang et al.
Molecular nutrition & food research, 63(7), e1801322-e1801322 (2019-01-12)
High fat (HF)-diet-induced insulin resistance is a major contributor to the pathogenesis of cardiovascular diseases. However, the molecular mechanisms that regulate cardiac insulin signaling are not fully understood. The regulatory role of tafazzin in the hearts of HF-diet-fed mice is
Libo Yan et al.
Archives of biochemistry and biophysics, 562, 31-36 (2014-08-01)
The Hippo-YAP pathway is altered and implicated as an oncogenic signaling pathway in many human cancers. Hypoxia is an important microenvironmental factor that promotes tumorigenesis. However, the effects of hypoxia on the two most important Hippo-YAP effectors, YAP (Yes-associated protein)
M Shanzer et al.
Oncogene, 34(32), 4190-4198 (2014-11-05)
The polyomavirus middle T antigen (PyMT) is an oncogene that activates the non-receptor tyrosine kinase, c-Src, and physically interacts with Taz (WWTR1). Taz is a pro-oncogenic transcription coactivator of the Tead transcription factors. The Hippo tumor suppressor pathway activates the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service