Skip to Content
Merck
All Photos(1)

Documents

EHU066621

Sigma-Aldrich

MISSION® esiRNA

targeting human ARID1A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACATCCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGGTTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCATTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGGGAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAAGAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATGATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGAGAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGATCCATTTGTGGTGGACTGCTCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu-Chun Tseng et al.
Molecular reproduction and development, 84(12), 1250-1256 (2017-11-28)
Mammalian embryos undergo dramatic epigenetic remodeling that can have a profound impact on both gene transcription and overall embryo developmental competence. Members of the SWI/SNF (Switch/Sucrose non-fermentable) family of chromatin-remodeling complexes reposition nucleosomes and alter transcription factor accessibility. These large
Yan Yang et al.
Anti-cancer drugs, 31(4), 368-376 (2020-01-09)
Gastric cancer (GC) is lethal and there is an urgent need for improved understanding of this disease. Recent studies have reported that microRNAs (miRNAs) play increasingly important roles in the regulation of GC. In this study, we explored the target
Wen Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2420-2433 (2017-10-27)
We previously performed microRNA (miRNA) microarray to identify effective indicators of clear cell renal cell carcinoma (ccRCC) tissue samples and preoperative/postoperative plasma in which we identified miR-144-3p as an oncomiRNA. However, the molecular mechanism of miR-144-3p remains unclear. This study
Dakeun Lee et al.
OncoTargets and therapy, 10, 4153-4159 (2017-09-02)
The At-rich interactive domain 1A (ARID1A) is frequently mutated in gastric cancers (GCs) with a poor prognosis. Growing evidence indicates that loss of ARID1A expression leads to activation of the phosphatidylinositol 3-kinase (PI3K)/AKT pathway by AKT phosphorylation. We aim to
Saravana P Selvanathan et al.
Nucleic acids research, 47(18), 9619-9636 (2019-08-09)
Connections between epigenetic reprogramming and transcription or splicing create novel mechanistic networks that can be targeted with tailored therapies. Multiple subunits of the chromatin remodeling BAF complex, including ARID1A, play a role in oncogenesis, either as tumor suppressors or oncogenes.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service