Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU041221

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gpr109a

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTTGCTTCTTGTGGGGTCTCACCATCGGCCTGACTGTCCACCTCCTCTATACAAACATGATGACCAAAAATGGCGAGGCATATCTGTGTAGCAGCTTCAGCATCTGTTACAACTTCAGGTGGCACGATGCTATGTTCCTCTTGGAATTCTTCTTGCCCCTGGCCATCATCTTGTTCTGCTCAGGCAGGATCATCTGGAGCCTGAGGCAGAGACAGATGGACAGACATGCCAAGATCAAGAGGGCCATCAACTTCATCATGGTGGTGGCTATTGTATTCATCATTTGCTTCCTACCCAGTGTGGCTGTGCGCATCCGCATCTTCTGGCTTCTCTACAAATATAACGTACGCAACTGTGACATCTACTCCTCGGTGGACCTGGCTTTCTTTACCACCCTTAGCTTTACCTACATGAACAGCATGCTGGACCCTGTGGTCTACTATTTCTCCAGCCCATCTTTCCCCAACTTCTTCTCCACGTGTATCAACCGCTGCCTTCGAAAGAAAACATTGGGTGAACCCGATA

Numéro d'accès Ensembl | souris

ENSMUSG00000045502

Numéro d'accès NCBI

NM_030701

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... GPR109A(80885) , Gpr109a(80885)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and
Banabihari Giri et al.
International journal of molecular sciences, 20(18) (2019-09-22)
In this study, we used macrophage RAW264.7 cells to elucidate the molecular mechanism underlying the anti-inflammatory actions of niacin. Anti-inflammatory actions of niacin and a possible role of its receptor GPR109A have been studied previously. However, the precise molecular mechanism
Genki Hayashi et al.
Human molecular genetics, 26(15), 2864-2873 (2017-05-02)
The induction of mitochondrial biogenesis could potentially alleviate mitochondrial and muscle disease. We show here that dimethyl fumarate (DMF) dose-dependently induces mitochondrial biogenesis and function dosed to cells in vitro, and also dosed in vivo to mice and humans. The
Samar Rezq et al.
The Journal of pharmacology and experimental therapeutics, 356(2), 456-465 (2015-12-02)
G protein-coupled receptor 109A (GPR109A) activation by its ligand nicotinic acid (NA) in immune cells increases Ca(2+) levels, and Ca(2+) induces glutamate release and oxidative stress in central blood pressure (BP)-regulating nuclei, for example, the rostral ventrolateral medulla (RVLM), leading

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique