Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU151161

Sigma-Aldrich

MISSION® esiRNA

targeting human MZF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGATGGGTCACAGTCCAGGTGCAGGGCCAGGAGGTCCTATCAGAGAAGATGGAGCCCTCCAGTTTCCAGCCCCTACCTGAAACTGAGCCTCCAACTCCAGAGCCTGGGCCCAAGACACCTCCTAGGACTATGCAGGAATCACCACTGGGCCTGCAGGTGAAAGAGGAGTCAGAGGTTACAGAGGACTCAGATTTCCTGGAGTCTGGGCCTCTAGCTGCCACCCAGGAGTCTGTACCCACCCTCCTGCCTGAGGAGGCCCAGAGATGTGGGACCGTGCTGGACCAGATCTTTCCCCACAGCAAGACTGGGCCTGAGGGTCCCTCATGGAGGGAGCACCCCAGGGCCCTGTGGCATGAGGAAGCTGGGGGCATCTTCTCCCCAGGGTTCGCGCTGCAGCTAGGCAGCATCTCCGCAGGTCCAGGTAGTGTAAGCCCTCACCTCCAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

C E Weber et al.
Oncogene, 34(37), 4821-4833 (2014-12-23)
Interactions between tumor cells and cancer-associated fibroblasts (CAFs) in the tumor microenvironment significantly influence cancer growth and metastasis. Transforming growth factor-β (TGF-β) is known to be a critical mediator of the CAF phenotype, and osteopontin (OPN) expression in tumors is
Lanfang Wu et al.
The FEBS journal, 284(18), 3000-3017 (2017-07-14)
Tumor metastasis remains a major obstacle for improving overall cancer survival in cervical cancer (CC), which may be due to the existence of tumor microenvironment-related cancer stem cells (CSCs) and epithelial-mesenchymal transition (EMT). The mechanism underlying these processes needs to
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique