Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU136281

Sigma-Aldrich

MISSION® esiRNA

targeting human NPC1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGATTGTGGTGTTGGCTTTTGCCAAATCTCAAATTTTCCAGATATTCTACTTCAGGATGTATTTGGCCATGGTCTTACTGGGAGCCACTCACGGATTAATATTTCTCCCTGTCTTACTCAGTTACATAGGGCCATCAGTAAATAAAGCCAAAAGTTGTGCCACTGAAGAGCGATACAAAGGAACAGAGCGCGAACGGCTTCTAAATTTCTAGCCCTCTCGCAGGGCATCCTGACTGAACTGTGTCTAAGGGTCGGTCGGTTTACCACTGGACGGGTGCTGCATCGGCAAGGCCAAGTTGAACACCGGATGGTGCCAACCATCGGTTGTTTGGCAGCAGCTTTGAACGTAGCGCCTGTGAACTCAGGAATGCACAGTTGACTTGGGAAGCAGTATTACTAGATCTGGAGGCAACCACAGGACACTAAACTTCTCCCAGCCTCTTCAGGAAAGAAACCTCATTCTTTGGCAAGCAGGAGGTGACACTAGATGGCTGTGAATGTGATCCGCTCACTGACACTCTGTAAAGGCCAATCAATGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoyang Xu et al.
Journal of cellular and molecular medicine, 21(2), 364-374 (2016-09-16)
Statins, 3-hydroxyl-3-methylglutaryl coenzyme A reductase inhibitors, are the first-line medications prescribed for the prevention and treatment of coronary artery diseases. The efficacy of statins has been attributed not only to their systemic cholesterol-lowering actions but also to their pleiotropic effects
Yudong Song et al.
Biomaterials, 150, 1-13 (2017-10-14)
Arginine and α-tocopherol succinate (α-TOS) double grafted N-trimethyl chitosan chloride (TMC) nanoparticles (TAS NPs) were designed and developed for effective co-delivery of doxorubicin (DOX) and Survivin shRNA-expressing pDNA (iSur-pDNA). With DOX loading into the hydrophobic core and iSur-pDNA combining to
Saskia Heybrock et al.
Nature communications, 10(1), 3521-3521 (2019-08-08)
The intracellular transport of cholesterol is subject to tight regulation. The structure of the lysosomal integral membrane protein type 2 (LIMP-2, also known as SCARB2) reveals a large cavity that traverses the molecule and resembles the cavity in SR-B1 that
Guanghong Liao et al.
Experimental neurology, 269, 67-74 (2015-04-14)
Niemann-Pick type C (NPC) disease is a genetic disorder associated with intracellular cholesterol accumulation in the brain and other organs, and neurodegeneration is generally believed to be the fatal cause of the disease. In view of the emerging role of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique