Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU124061

Sigma-Aldrich

MISSION® esiRNA

targeting human TSG101

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAATGCCTTGAAACGAACAGAAGAAGACCTGAAAAAGGGTCACCAGAAACTGGAAGAGATGGTTACCCGTTTAGATCAAGAAGTAGCCGAGGTTGATAAAAACATAGAACTTTTGAAAAAGAAGGATGAAGAACTCAGTTCTGCTCTGGAAAAAATGGAAAATCAGTCTGAAAACAATGATATCGATGAAGTTATCATTCCCACAGCTCCCTTATACAAACAGATCCTGAATCTGTATGCAGAAGAAAACGCTATTGAAGACACTATCTTTTACTTGGGAGAAGCCTTGAGAAGGGGCGTGATAGACCTGGATGTCTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAAGCAAGAAAGACTGCCGGTCTC

Numéro d'accès Ensembl | humain

ENSG00000074319

Numéro d'accès NCBI

NM_006292

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TSG101(7251) , TSG101(7251)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chen Xu et al.
Cellular & molecular biology letters, 24, 7-7 (2019-01-25)
The tumor susceptibility gene 101 (TSG101) is closely associated with various tumor types, but its role in the pathogenesis of renal cell carcinoma (RCC) is still unknown. This study used RNA interference to silence the expression of TSG101 in RCC
Jiin-Tsuey Cheng et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 134, 111106-111106 (2020-12-19)
Tumor Susceptibility Gene 101 (TSG101) is a member of endosomal sorting complexes responsible for endocytic pathway, which is associated with autophagic process. However, the role of TSG101 in autophagy remains unclear. To investigate the effect of TSG101 on the membrane-bound
Rutuja Kulkarni et al.
Scientific reports, 7(1), 14787-14787 (2017-11-03)
Exosomes are membrane enclosed nano-sized vesicles actively released into the extracellular milieu that can harbor genomic, proteomic and lipid cargos. Functionally, they are shown to regulate cell-cell communication and transmission of pathogens. Though studies have implicated a role for exosomes
Hamish W King et al.
BMC cancer, 12, 421-421 (2012-09-25)
Exosomes are nanovesicles secreted by tumour cells which have roles in paracrine signalling during tumour progression, including tumour-stromal interactions, activation of proliferative pathways and bestowing immunosuppression. Hypoxia is an important feature of solid tumours which promotes tumour progression, angiogenesis and
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique