Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU123831

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT3A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAATGACCTCTCCATCGTCAACCCTGCTCGCAAGGGCCTCTACGAGGGCACTGGCCGGCTCTTCTTTGAGTTCTACCGCCTCCTGCATGATGCGCGGCCCAAGGAGGGAGATGATCGCCCCTTCTTCTGGCTCTTTGAGAATGTGGTGGCCATGGGCGTTAGTGACAAGAGGGACATCTCGCGATTTCTCGAGTCCAACCCTGTGATGATTGATGCCAAAGAAGTGTCAGCTGCACACAGGGCCCGCTACTTCTGGGGTAACCTTCCCGGTATGAACAGGCCGTTGGCATCCACTGTGAATGATAAGCTGGAGCTGCAGGAGTGTCTGGAGCATGGCAGGATAGCCAAGTTCAGCAAAGTGAGGACCATTACTACGAGGTCAAACTCCATAAAGCAGGGCAAAG

Numéro d'accès Ensembl | humain

ENSG00000119772

Numéro d'accès NCBI

NM_022552

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DNMT3A(1788) , DNMT3A(1788)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xi Han et al.
Cell biology international, 45(1), 227-237 (2020-10-23)
Emerging evidence suggests that miR-143 plays an important role in the regulation of tumor sensitivity to chemotherapeutic agents. The study explores the underlying mechanism of miR-143 in reversing cisplatin resistance in ovarian cancer. The cisplatin-resistant ovarian cancer cell line A2780/CDDP
Yu Nomura et al.
Cells, tissues, organs, 207(3-4), 115-126 (2019-10-02)
Stem cells have essential applications in in vitro tissue engineering or regenerative medicine. However, there is still a need to understand more deeply the mechanisms of stem cell differentiation and to optimize the methods to control stem cell function. In
Li Zhang et al.
Cancer cell international, 20, 325-325 (2020-07-24)
Methylation of histone 3 at lysine 9 (H3K9) and DNA methylation are epigenetic marks correlated with genes silencing. The tumor microenvironment significantly influences therapeutic responses and clinical outcomes. The epigenetic-regulation mechanism of the costimulatory factors Tim-3 and galectin-9 in cervical
Anjin Wang et al.
Oncology letters, 21(4), 272-272 (2021-03-16)
Cervical cancer is the second most common gynecological malignancy. Accumulating evidence has suggested that microRNAs (miRNAs) are involved in the occurrence and development of cervical cancer. The present study aimed to investigate the function and underlying molecular mechanism of microRNA
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique