Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU123221

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCT

Numéro d'accès Ensembl | humain

ENSG00000141510

Numéro d'accès NCBI

NM_000546

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TP53(7157) , TP53(7157)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mingyan Lin et al.
BMC systems biology, 10(1), 105-105 (2016-11-17)
Individuals with 22q11.2 Deletion Syndrome (22q11.2 DS) are a specific high-risk group for developing schizophrenia (SZ), schizoaffective disorder (SAD) and autism spectrum disorders (ASD). Several genes in the deleted region have been implicated in the development of SZ, e.g., PRODH
Yukihiro Furusawa et al.
Apoptosis : an international journal on programmed cell death, 22(10), 1225-1234 (2017-07-25)
Hyperthermia induced by heat stress (HS) is known to inhibit proliferation and induce cell death in cancer. We previously demonstrated that checkpoint kinase 1 (Chk1) contributes to G
Beilei Zhang et al.
Cancer letters, 459, 50-58 (2019-06-05)
MicroRNAs (miRNAs) were involved in cancer progression, and the targeting of miRNAs by natural agents has opened avenues for cancer treatment and drug development. miR-16 functions as a tumor suppressor and is frequently deleted or downregulated in various human cancers
Bin Zhang et al.
Journal of cellular and molecular medicine, 21(7), 1329-1341 (2017-02-13)
Gastric carcinoma is one of the most common malignancies worldwide and the second most frequent cause of cancer-related death in China. Protein regulator of cytokinesis 1 (PRC1) is involved in cytokinesis and plays key roles in microtubule organization in eukaryotes.
Vinod Vijay Subhash et al.
Molecular cancer therapeutics, 15(12), 3087-3096 (2016-09-18)
Identification of synthetically lethal cellular targets and synergistic drug combinations is important in cancer chemotherapy as they help to overcome treatment resistance and increase efficacy. The Ataxia Telangiectasia Mutated (ATM) kinase is a nuclear protein that plays a major role
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique