Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU118761

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCTGTGACACTCTGTTGATGTGCATCGTCACTGTCATGAACCATGGGCTACGCAACGGTGGTGGCGTGGGCGACATTCTCCGCAAGCCCTCCAAAGATGAGTCTCTCTTCCCAGCCCGAGTGGTCTATGACCTCCTGTTCTTCTTCATCGTCATCATCATTGTGCTGAACCTCATCTTTGGGGTAATCATCGACACCTTCGCTGACCTGCGTAGTGAGAAGCAGAAGAAGGAGGAGATTCTTAAGACGACATGCTTCATCTGTGGTCTGGAGAGGGACAAGTTTGATAACAAGACAGTGTCATTTGAGGAACACATCAAGCTGGAGCACAACATGTGGAACTACTTGTACTTCATTGTGCTGGTCCGCGTGAAGAACAAGACCGACTACACGGGCCCTGAGAGCTACGTGGCCCAGATGATCAAGAACAAGAACCTGGACTGGTTCCCCCGGATGCGGGCCATGTCCCTTGTCAGCAATGAGGGCGAGGGGGAGCAGAATGAGATTCGGATTCTCCAGGACAAGCTCAACTCCACCATGA

Numéro d'accès Ensembl | humain

ENSG00000096433

Numéro d'accès NCBI

NM_002224

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ITPR3(3710) , ITPR3(3709)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Francesca Iommelli et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(13), 3126-3136 (2018-04-06)
Purpose: Our aim was to test whether imaging with 18F-fluorothymidine (18F-FLT) PET/CT was able to detect the combined effects of EGFR and MET inhibitors in oncogene-driven non-small cell lung cancer (NSCLC) and to elucidate the mechanisms underlying the enhanced efficacy
Julius Rönkkö et al.
Annals of clinical and translational neurology, 7(10), 1962-1972 (2020-09-20)
ITPR3, encoding inositol 1,4,5-trisphosphate receptor type 3, was previously reported as a potential candidate disease gene for Charcot-Marie-Tooth neuropathy. Here, we present genetic and functional evidence that ITPR3 is a Charcot-Marie-Tooth disease gene. Whole-exome sequencing of four affected individuals in
Ming He et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(5), 902-914 (2019-03-29)
Objective- The topographical distribution of atherosclerosis in vasculature underscores the importance of shear stress in regulating endothelium. With a systems approach integrating sequencing data, the current study aims to explore the link between shear stress-regulated master transcription factor and its
Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Zheng Zeng et al.
Journal of pharmacological sciences, 126(1), 37-46 (2014-09-23)
This study determined the regulatory effect of inositol 1,4,5-trisphosphate receptors (IP3Rs) on the basal Ca(2+) transients in cardiomyocytes. In cultured neonatal rat ventricular myocytes (NRVMs) at different densities, we used confocal microscopy to assess the effect of IP3Rs on the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique