Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU084091

Sigma-Aldrich

MISSION® esiRNA

targeting human ARRB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCACGCTTACCCTTTCACCTTTGAGATCCCTCCAAACCTTCCATGTTCTGTGACACTGCAGCCGGGGCCCGAAGACACGGGGAAGGCTTGCGGTGTGGACTATGAAGTCAAAGCCTTCTGCGCGGAGAATTTGGAGGAGAAGATCCACAAGCGGAATTCTGTGCGTCTGGTCATCCGGAAGGTTCAGTATGCCCCAGAGAGGCCTGGCCCCCAGCCCACAGCCGAGACCACCAGGCAGTTCCTCATGTCGGACAAGCCCTTGCACCTAGAAGCCTCTCTGGATAAGGAGATCTATTACCATGGAGAACCCATCAGCGTCAACGTCCACGTCACCAACAACACCAACAAGACGGTGAAGAAGATCAAGATCTCAGTGCGCCAGTATGCAGACATCTGCCTTTTCAACACAGCTCAGTACAAGTGCCCTGTTGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Susanne Neumann et al.
The Journal of pharmacology and experimental therapeutics, 364(1), 38-45 (2017-11-02)
Recently, we showed that TSH-enhanced differentiation of a human preosteoblast-like cell model involved a β-arrestin 1 (β-Arr 1)-mediated pathway. To study this pathway in more detail, we sought to discover a small molecule ligand that was functionally selective toward human
Rui Yamaguchi et al.
The American journal of the medical sciences, 357(6), 492-506 (2019-03-27)
Plasminogen activator inhibitor type 1 promotes formation of endothelial microparticles with procoagulant activity. However, it remains unclear whether di-(2-ethylhexyl) phthalate, a peroxisome proliferator-activated receptor α agonist, influences microparticle formation. The effect of di-(2-ethylhexyl) phthalate on release of tissue factor-bearing microparticles
Vincent Zecchini et al.
The EMBO journal, 33(12), 1365-1382 (2014-05-20)
Tumour cells sustain their high proliferation rate through metabolic reprogramming, whereby cellular metabolism shifts from oxidative phosphorylation to aerobic glycolysis, even under normal oxygen levels. Hypoxia-inducible factor 1A (HIF1A) is a major regulator of this process, but its activation under

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique