Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU083661

Sigma-Aldrich

MISSION® esiRNA

targeting human WT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGGGCATGTGTATGTGTCTGCTAATGTAAACTTTGTCATGGTTTCCATTTACTAACAGCAACAGCAAGAAATAAATCAGAGAGCAAGGCATCGGGGGTGAATCTTGTCTAACATTCCCGAGGTCAGCCAGGCTGCTAACCTGGAAAGCAGGATGTAGTTCTGCCAGGCAACTTTTAAAGCTCATGCATTTCAAGCAGCTGAAGAAAAAATCAGAACTAACCAGTACCTCTGTATAGAAATCTAAAAGAATTTTACCATTCAGTTAATTCAATGTGAACACTGGCACACTGCTCTTAAGAAACTATGAAGATCTGAGATTTTTTTGTGTATGTTTTTGACTCTTTTGAGTGGTAATCATATGTGTCTTTATAGATGTACATACCTCCTTGCACAAATGGAG

Numéro d'accès Ensembl | humain

ENSG00000184937

Numéro d'accès NCBI

NM_024425

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... WT1(7490) , WT1(7490)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xue Wang et al.
Theriogenology, 148, 8-17 (2020-03-04)
To determine the role of 3, 3', 5-triiodo-L thyroxine (T3) in the differentiation of Sertoli cells (SCs) and the factors influencing maturity via the Wilms' tumor 1 (WT1)/non-canonical Wnt signaling pathway, high purity SCs were isolated from newborn calves' testes
Junjie Chen et al.
Journal of experimental & clinical cancer research : CR, 35(1), 173-173 (2016-11-09)
The metastatic cascade is a complex and multistep process with many potential barriers. Recently, miR-193a has been reported to be a suppressive miRNA in multiple types of cancers, but its underlying anti-oncogenic activity in non-small cell lung cancers (NSCLC) is
Tove Ullmark et al.
Biochemical and biophysical research communications, 482(4), 802-807 (2016-11-28)
Wilms' tumor gene 1 (WT1) is a zinc finger transcription factor that has been implicated as an oncogene in leukemia and several other malignancies. When investigating possible gene expression network partners of WT1 in a large acute myeloid leukemia (AML)
Xue Wang et al.
Reproduction, fertility, and development, 32(5), 522-530 (2020-02-06)
The gap junction protein connexin (Cx) 43 between adjacent Sertoli cells (SCs) is the main testicular factor regulating the growth and development of SCs, and plays a vital role in controlling cell differentiation and maturation. However, the endogenous testicular factors
Fei Gao et al.
Reproduction (Cambridge, England), 148(4), 377-387 (2014-07-18)
The Wilms' tumour 1 (WT1) gene originally identified as a tumour suppressor associated with WTs encodes a zinc finger-containing transcription factor that is expressed in multiple tissues and is an important regulator of cellular and organ growth, proliferation, development, migration
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique