Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU067061

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCAACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAGTTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGGGGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGCATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTCCAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGCCCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAGTGTGAAGACTGCGGCAT

Numéro d'accès Ensembl | humain

ENSG00000163932

Numéro d'accès NCBI

NM_006254

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRKCD(5580) , PRKCD(5580)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zoé Lama et al.
Antiviral research, 168, 51-60 (2019-05-10)
Rabies virus (RABV) is a neurotropic virus that causes fatal encephalitis in humans and animals and still kills up to 59,000 people worldwide every year. To date, only preventive or post-exposure vaccination protects against the disease but therapeutics are missing.
Markus Dietrich et al.
Experimental cell research, 382(2), 111473-111473 (2019-06-25)
ErbB3, which belongs to the epidermal growth factor receptor (EGFR) or ErbB family of receptor tyrosine kinases, is involved in progression of several human cancers and a tight regulation of its expression is crucial. An important mechanism for regulation of
Sara G Pollan et al.
Oncogene, 37(21), 2817-2836 (2018-03-08)
Tumor metastasis depends on the dynamic regulation of cell adhesion through β1-integrin. The Cub-Domain Containing Protein-1, CDCP1, is a transmembrane glycoprotein which regulates cell adhesion. Overexpression and loss of CDCP1 have been observed in the same cancer types to promote
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique