Skip to Content
Merck
All Photos(1)

Key Documents

EHU107781

Sigma-Aldrich

MISSION® esiRNA

targeting human FFAR3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACAACGTGTCCCATGTCGTGGGCTATATCTGCGGTGAAAGCCCGGCGTGGAGGATCTACGTGACGCTTCTCAGCACCCTGAACTCCTGTGTCGACCCCTTTGTCTACTACTTCTCCTCCTCCGGGTTCCAAGCCGACTTTCATGAGCTGCTGAGGAGGTTGTGTGGGCTCTGGGGCCAGTGGCAGCAGGAGAGCAGCATGGAGCTGAAGGAGCAGAAGGGAGGGGAGGAGCAGAGAGCGGACCGACCAGCTGAAAGAAAGACCAGTGAACACTCACAGGGCTGTGGAACTGGTGGCCAGGTGGCCTGTGCTGAAAGCTAGGTCCTCCGGGGGAGGAGGGTGTAGCTGGCATGTCATCCTCAGGGCGCTTCCTCGCTCACGCCAGGAGGGACTTGGAGTGGCGAGCTGGGGCCCGATGGGGCTTGGGGGCAGAGTAGACATCTAGCCTCCCTAAGGGTATGCGCGCTAAAGCCCAGCTCTCGATCTCACCTCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hope Eveline Carter Moylan et al.
Molecular human reproduction, 26(6), 452-468 (2020-04-03)
Spontaneous preterm birth is a global health issue affecting up to 20% of pregnancies and leaves a legacy of neurodevelopmental complications. Inflammation has been implicated in a significant proportion of preterm births, where pro-inflammatory insults trigger production of additional pro-inflammatory
Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Estela Lorza-Gil et al.
Scientific reports, 10(1), 16497-16497 (2020-10-07)
The expression of short chain fatty acid receptors FFA2 and FFA3 in pancreatic islets raised interest in using them as drug targets for treating hyperglycemia in humans. This study aims to examine the efficacy of synthetic FFA2- and FFA3-ligands to
Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and
Zhenhua Zhou et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 41(2), 267-281 (2020-03-11)
Sodium butyrate, a short-chain fatty acid, is predominantly produced by gut microbiota fermentation of dietary fiber and serves as an important neuromodulator in the central nervous system. Recent experimental evidence has suggested that sodium butyrate may be an endogenous ligand

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service