Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU180041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mll1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCAGCTCTGCAAGATTGAGAAGAGTAAGAGTCTCAAACAGACTGACCAGCCCAAAGCACAGGGTCAAGAAAGTGATTCATCAGAAACCTCTGTTCGAGGACCCCGGATTAAACATGTCTGCAGAAGAGCTGCTGTTGCCCTTGGCCGCAAACGAGCTGTGTTTCCTGATGACATGCCCACCTTGAGTGCCTTACCGTGGGAAGAACGAGAAAAAATTTTGTCTTCCATGGGGAATGATGACAAGTCATCAGTTGCTGGCTCAGAAGATGCCGAGCCTCTTGCTCCTCCCATCAAACCAATTAAGCCTGTCACCAGAAACAAGGCACCTCAGGAGCCTCCGGTGAAGAAAGGGCGGCGATCAAGGCGGTGCGGACAATGTCCTGGCTGCCAGGTGCCTGAGGACTGTGGCATTTGCACTAATTGCCTGGACAAGCCCAAGTTTGGTGGCCGCAATATAAAGAAGCAATGCTGCAAGATGAGGAAATGTCAGAATCTGCAGTGGATGCCTTC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gregory C Addicks et al.
Nature communications, 10(1), 4256-4256 (2019-09-20)
PAX7 is a paired-homeobox transcription factor that specifies the myogenic identity of muscle stem cells and acts as a nodal factor by stimulating proliferation while inhibiting differentiation. We previously found that PAX7 recruits the H3K4 methyltransferases MLL1/2 to epigenetically activate
Yong-Sun Maeng et al.
BMC medical genomics, 8, 74-74 (2015-11-11)
TGFβ1-induced expression of transforming growth factor β-induced protein (TGFBIp) and extracellular matrix (ECM) genes plays a major role in the development of granular corneal dystrophy type 2 (GCD2: also called Avellino corneal dystrophy). Although some key transcription factors are known

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique