Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU177361

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Arid1a

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGATCAGATGGGAAAGATGAGACCTCAGCCGTATGGTGGGACTAACCCATACTCGCAACAACAGGGACCTCCTTCAGGACCGCAACAAGGACATGGGTACCCAGGGCAGCCATATGGGTCCCAGACTCCACAGCGGTACCCCATGACCATGCAGGGCCGGGCTCAGAGTGCCATGGGCAGCCTCTCTTATGCACAGCAGATTCCACCTTATGGCCAGCAAGGCCCCAGTGCGTATGGCCAGCAGGGCCAGACTCCATACTATAACCAGCAAAGTCCTCATCCCCAGCAGCAGCCACCTTACGCCCAGCAACCACCATCCCAGACCCCTCATGCCCAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nan Wang et al.
Gynecologic oncology, 134(1), 129-137 (2014-05-06)
MicroRNAs(miRNAs) play important roles in tumor development and progression. The purposes of this study were to investigate the role of miR-31 in cervical cancer and clarified the regulation of ARID1A by miR-31. Quantitative RT-PCR was used to examine miR-31 expression
Xuxu Sun et al.
Cancer cell, 32(5), 574-589 (2017-11-15)
ARID1A, an SWI/SNF chromatin-remodeling gene, is commonly mutated in cancer and hypothesized to be tumor suppressive. In some hepatocellular carcinoma patients, ARID1A was highly expressed in primary tumors but not in metastatic lesions, suggesting that ARID1A can be lost after

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique