Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU086511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thpo

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACAGCTGTCCCAAGCAGTACTTCTCAACTCCTCACACTAAACAAGTTCCCAAACAGGACTTCTGGATTGTTGGAGACGAACTTCAGTGTCACAGCCAGAACTGCTGGCCCTGGACTTCTGAGCAGGCTTCAGGGATTCAGAGTCAAGATTACTCCTGGTCAGCTAAATCAAACCTCCAGGTCCCCAGTCCAAATCTCTGGATACCTGAACAGGACACACGGACCTGTGAATGGAACTCATGGGCTCTTTGCTGGAACCTCACTTCAGACCCTGGAAGCCTCAGACATCTCGCCCGGAGCTTTCAACAAAGGCTCCCTGGCATTCAACCTCCAGGGTGGACTTCCTCCTTCTCCAAGCCTTGCTCCTGATGGACACACACCCTTCCCTCCTTCACCTGCCTTGCCCACCACCCATGGATCTCCACCCCAGCTCCACCCCCTGTTTCCTGACCCTTCCACCACCATGCCTAACTCTACCGCCCCTCATCCAGTCACAATGTACCCTCATCCCAGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lina M E Pettersson et al.
PloS one, 9(6), e100730-e100730 (2014-06-27)
Peripheral nerve injury results in dramatic upregulation in pituitary adenylate cyclase activating polypeptide (PACAP) expression in adult rat dorsal root ganglia and spinal motor neurons mirroring that described for the neurotrophin brain derived neurotrophic factor (BDNF). Thus, we posited that
Sae Hyun Park et al.
International journal of oncology, 44(3), 637-646 (2014-01-01)
Fascin1 (FSCN1) involved in cell motility and filopodia assembly plays important roles in biological processes such as cancer invasion and metastasis of multiple epithelial tumors. High-grade serous ovarian carcinoma (HGSOC) is aggressive and metastatic by acquiring an invasive phenotype and
Peng Zhang et al.
PloS one, 9(5), e97647-e97647 (2014-05-17)
Plasma kisspeptin levels dramatically increased during the first trimester of human pregnancy, which is similar to pregnancy specific glycoprotein-human chorionic gonadotropin. However, its particular role in the implantation and decidualization has not been fully unraveled. Here, the study was conducted
Shihai Liu et al.
International journal of clinical and experimental pathology, 7(8), 4857-4866 (2014-09-10)
Glioblastoma tumor cells release microvesicles, which contain mRNA, miRNA and angiogenic proteins. These tumor-derived microvesicles transfer genetic information and proteins to normal cells. Previous reports demonstrated that the increased microvesicles in cerebrospinal fluid (CSF) of patients with glioblastoma up-regulate procoagulant
Linn-Karina M Selvik et al.
PloS one, 9(11), e112485-e112485 (2014-11-11)
Salt-inducible kinase 1 (SIK1/Snf1lk) belongs to the AMP-activated protein kinase (AMPK) family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique