Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU079271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Macc1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCACATCTGGCACAGGAAGATTTTAATAGAATTCAAGCAGACAAGGAACCAGAAAGGGTTTCTTACGTTGTCAAGAAGTTAAAGGAAGATTGCCATGAAGATAGAAATACCAGGAAGTTCCTTTATGAACTGATTGTGGCTCTGCTAAAAATGGATTGCCAAGAGTTAGTGGCACATCTTATCCAAGAGGCTGTTATTCTGACTTCAGCTGTGAAACTTGGAAGAAGCTGGAGGGAACTTGCTGAGAAATCTGCAGGACTCACTAAGCATCAGATGCAGGCATATGAAATTCCTCACCGAGGAAAATCTGGAGATGTTTCAGCAGAGATGATGTGGAAACCTGCCTATGATTTTCTCTATGCATGGAGTTTTCACTATGGAAATAGCTACAGAGATGTGTTACAAGATCTTCAATCAGCTTTGGACAGAATGAAAAACCCTGTCACTAAACGGTGGAGA

Numéro d'accès Ensembl | souris

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yaoqing Li et al.
Molecular medicine reports, 12(1), 426-434 (2015-03-05)
Metastasis-associated in colon cancer-1 (MACC1) is a newly identified gene that is involved in the development and progression of hepatocellular carcinoma (HCC), however its investigation has not been comprehensive. In the present study, in vitro techniques, including immunohistochemistry, western blotting
Aiko Sueta et al.
International journal of oncology, 46(5), 2143-2153 (2015-03-05)
The newly identified gene, metastasis‑associated in colon cancer 1 (MACC1), is suggested to be a transcriptional regulator of c‑Met, leading to cancer progression in colorectal cancer. To date however, little is known of the role of MACC1 in breast cancer.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique