Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU067571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Creb1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGGGTGCCAAGGATTGAAGAAGAAAAGTCAGAAGAGGAGACTTCAGCCCCTGCCATCACCACTGTAACAGTGCCAACCCCCATTTACCAAACTAGCAGTGGGCAGTACATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACGGATGGGGTACAGGGCCTGCAGACATTAACCATGACCAATGCAGCTGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATTCTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCAGGCGATGTACAAACATACCAGATCCGCACAGCACCCACGAGCACCATTGCCCCTGGAGTTGTTA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mutsumi Fujii et al.
Experimental neurology, 261, 396-403 (2014-07-25)
Early brain injury (EBI) which comprises of vasogenic edema and apoptotic cell death is an important component of subarachnoid hemorrhage (SAH) pathophysiology. This study evaluated whether cannabinoid receptor type 2 (CB2R) agonist, JWH133, attenuates EBI after SAH and whether CB2R
Jian Ye et al.
EMBO molecular medicine, 6(10), 1294-1311 (2014-09-19)
Accumulating evidence suggests the immunosuppressive microenvironments created by malignant tumors represent a major obstacle for effective anti-tumor immunity. A better understanding of the suppressive mechanisms mediated by tumor microenvironments and the development of strategies to reverse the immune suppression are
Wencheng Li et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 309(2), R138-R147 (2015-05-23)
We reported that brain (pro)renin receptor (PRR) expression levels are elevated in DOCA-salt-induced hypertension; however, the underlying mechanism remained unknown. To address whether ANG II type 1 receptor (AT1R) signaling is involved in this regulation, we implanted a DOCA pellet
Kaiyan Hui et al.
Cancer letters, 354(1), 189-199 (2014-08-17)
Supranutritional selenite has anti-cancer therapeutic effects in vivo; however, the detailed mechanisms underlying these effects are not clearly understood. Further studies would broaden our understanding of the anti-cancer effects of this compound and provide a theoretical basis for its clinical
Xiuying Ma et al.
Oncology reports, 35(1), 189-196 (2015-11-05)
In the periphery of pancreatic ductal adenocarcinoma (PDAC), high accumulation of tumor-associated macrophages (TAMs), which exhibit M2 phenotype, has been shown to be correlated with extra-pancreatic invasion, lymph vessel invasion, lymph node involvement and shortened survival time. However, mechanisms by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique