Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU065851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Skp2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCCTCGGCTGCAGATTAACTGCGCCTATTTCACCACCATTGCAAGGCCAACTATGGACAGCAAGAAGAACCTGGAGATTTGGGGTATCAAGTGCCGACTGACTCTGCAAAAGCCCAGTTGTCTATGAAGTGCTTACCGCAGAGCGGTGTTTCCTCTGGAACGAGGAAAGCAGGCAGCAAGTCCGCATGCTGGAGACCTTGGTTACTCTTCCTATTGGCTTTGCCTTAGCCTTCACTTTATATGTATGTTAGGGAACCATTTGCGAGGGGGACAGCCACGAAGTGTTACTTTTTCAAAACTATAGAGCCGATTCTGTCAGTGCTGTGCCCTAAGGGCCTAAGCGGCAGGTCTTTGGAGATTTTAGGAGAGCCTATGATTTCAGCATGCTTTTTTAAAAGCGACATTTGAGCCAAC

Numéro d'accès Ensembl | souris

ENSMUSG00000054115

Numéro d'accès NCBI

NM_145468

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... SKP2(27401) , Skp2(27401)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Wenfu Lu et al.
Oncotarget, 6(2), 771-788 (2015-01-19)
Aberrant elevation of JARID1B and histone H3 lysine 4 trimethylation (H3K4me3) is frequently observed in many diseases including prostate cancer (PCa), yet the mechanisms on the regulation of JARID1B and H3K4me3 through epigenetic alterations still remain poorly understood. Here we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique