Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU063601

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ntn1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACTGCCACTACTGCAAGGAGGGCTTCTACCGAGACATGGGCAAGCCTATCACCCACCGGAAGGCTTGCAAAGCCTGTGATTGCCACCCAGTGGGTGCTGCTGGCAAGACCTGCAATCAAACCACTGGCCAATGTCCCTGCAAGGACGGCGTGACGGGCATCACCTGCAACCGATGTGCCAAAGGCTACCAGCAGAGCCGTTCCCCCATCGCCCCTTGCATCAAGATTCCTGTGGCGCCGCCCACCACTGCAGCCAGCAGCGTGGAGGAACCGGAAGACTGTGATTCCTATTGCAAGGCCTCCAAAGGCAAGCTGAAGATGAACATGAAGAAATACTGCAGGAAGGACTATGCTGTCCAGATCCACATCCTGAAGGCCGACAAAGCAGGGGACTGGTGGAAGTTCACCGT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ping Han et al.
American journal of cancer research, 5(4), 1396-1409 (2015-06-24)
The axon guidance cues netrin-1 has been reported to be associated with cancer progression in various types of human cancers. However, the underlying molecular mechanism of netrin-1-mediated metastasis remains obscure. In this study, we found that overexpression of netrin-1 promoted
Punithavathi Ranganathan et al.
Journal of cellular and molecular medicine, 18(7), 1290-1299 (2014-04-12)
The netrin-1 administration or overexpression is known to protect colon from acute colitis. However, the receptor that mediates netrin-1 protective activities in the colon during colitis remains unknown. We tested the hypothesis that UNC5B receptor is a critical mediator of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique