Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU060181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rnmt

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGAGAAGCAGCAGTGAGCACGTTGCTTTAGAGCAGCACTCCATCCTCCCAGGTGGAGCAGACCATCTCAGAAACATTTGACAGCTGTTTGTTTATTTTAATAGTAAGTTCTCAATGTGTAGGATGCTGCCACAAACTTCAGTGTATGAATTTGACACTTACTGTCTGTGACAGGTTAGCATAATGTGTGTACATAGGGATGAGTTGTCTTGAAGATCTATTTTTAAGTACTGTTGTAATTGTTCCCCTCTACTGTCAAAACTCTAGCAAGGCATGTCAGAGCAGCTGACCTCCCCAGTGCTGTGATGTGTGAGCAGCTGACCTCCCCAGTGCTGGGATGTGTGAATGTGTTTACAGAGCTGATTTGACAGTCGCTAGAATTGGCAGAGGAACGTTCAC

Numéro d'accès Ensembl | souris

ENSMUSG00000009535

Numéro d'accès NCBI

NM_026440

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... RNMT(67897) , Rnmt(67897)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Katarzyna Miekus et al.
Oncotarget, 6(12), 10086-10101 (2015-04-19)
Cervical cancer is one of the leading causes of death among women suffering from tumors. Current treatment options are insufficient. Here, we investigated the MET receptor as a potential molecular target in advanced cervical cancer. Downregulation of MET receptor expression
Young-Won Kim et al.
PloS one, 10(7), e0134552-e0134552 (2015-08-01)
Previous studies have shown that c-MET is overexpressed in cases of aggressive bladder cancer (BCa). Identification of crosstalk between c-MET and other RTKs such as AXL and PDGFR suggest that c-MET network genes (c-MET-AXL-PDGFR) may be clinically relevant to BCa.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique