Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU053941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Itgae

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTGGACCACTACAAGGAACCCTCTGCCATCTTCCAGCTGCCCTACGAGAAGGACTGCAAGAACAAAGTGTTCTGCATCGCTGAGATCCAGCTGACCACCAACATCTCCCAGCAGGAACTGGTGGTGGGCGTCACAAAGGAGGTGACCATGAACATCAGCCTGACTAACTCTGGAGAGGATTCCTACATGACAAACATGGCTCTCAATTATCCCAGAAACTTACAGTTTAAGAAGATACAAAAGCCAGTATCTCCAGATGTTCAGTGTGATGACCCCAAGCCAGTTGCTTCTGTCCTGGTCATGAACTGCAAGATTGGTCACCCCATACTCAAGAGATCATCTGTGAATGTCTCAGTAACTTGGCAGCTAGAGGAGAGTGTCTTTCCAAATAGGACAGCAGATATCACTGTGACCATCTCCAATTCCAATGAGAAGTCTTTGGCCAGAGAGACACGCAGCCTTCAAT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jayashree Dolpady et al.
Journal of diabetes research, 2016, 7569431-7569431 (2016-01-19)
The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D) via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal
Verena Moosbrugger-Martinz et al.
Journal of cellular and molecular medicine, 20(5), 930-938 (2016-03-05)
Atopic dermatitis (AD) is a widespread inflammatory skin disease with an early onset, characterized by pruritus, eczematous lesions and skin dryness. This chronic relapsing disease is believed to be primarily a result of a defective epidermal barrier function associated with
Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique