Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU053261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rapgef3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTCTTTGAACCACACAGCAAGGCAGGAACTGTGTTGTTCAGCCAGGGGGACAAGGGTACCTCGTGGTACATTATCTGGAAGGGATCTGTCAATGTGGTGACCCATGGCAAGGGGCTGGTGACCACGTTGCACGAGGGAGATGACTTTGGACAGCTGGCTCTGGTGAACGACGCACCTCGGGCAGCCACCATCATCCTTCGAGAAAATAACTGTCACTTTCTGCGTGTGGACAAGCAGGACTTCAACCGCATCATCAAGGATGTGGAAGCAAAAACCATGAGACTGGAAGAACACGGCAAAGTGGTCTTAGTTCTGGAGAGAACCTCTCAGGGTGCTGGCCCTTCCCGTCCCCCGACCCCAGGCAGGAACCGGTATACGGTCATGTCTGGCACCCCAGAGAAAATCCTAGAACTGCTGTTGGAGGCTATGAGACCGGATTCCAGTGCTCATGACCCAACAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously
Ke Ke et al.
PloS one, 10(5), e0124869-e0124869 (2015-05-21)
Cilostazol has been reported to alleviate the metabolic syndrome induced by increased intracellular adenosine 3',5'-cyclic monophosphate (cAMP) levels, which is also associated with osteoclast (OC) differentiation. We hypothesized that bone loss might be attenuated via an action on OC by
Supachoke Mangmool et al.
Molecular endocrinology (Baltimore, Md.), 29(4), 583-596 (2015-02-27)
Although the cardioprotective effects of glucagon-like peptide-1 and its analogs have been reported, the exact mechanisms of the glucagon-like peptide-1 receptor (GLP-1R) signaling pathway in the heart are still unclear. Activation of the GLP-1R has been shown to increase cAMP
Pablo Muñoz-Llancao et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(32), 11315-11329 (2015-08-14)
Acquisition of neuronal polarity is a complex process involving cellular and molecular events. The second messenger cAMP is involved in axonal specification through activation of protein kinase A. However, an alternative cAMP-dependent mechanism involves the exchange protein directly activated by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique