Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU046111

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Npy

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGACTGACCCTCGCTCTATCTCTGCTCGTGTGTTTGGGCATTCTGGCTGAGGGGTACCCCTCCAAGCCGGACAATCCGGGCGAGGACGCGCCAGCAGAGGACATGGCCAGATACTACTCCGCTCTGCGACACTACATCAATCTCATCACCAGACAGAGATATGGCAAGAGATCCAGCCCTGAGACACTGATTTCAGACCTCTTAATGAAGGAAAGCACAGAAAACGCCCCCAGAACAAGGCTTGAAGACCCTTCCATGTGGTGATGGGAAATGAAACTTGTTCTCCCGACTTTTCCAAGTTTCCACCCTCATCTCATCTCATCCCCTGAAACCAGTCTGCCTGTCCCACCAATGCATGCCACCACTAGGCTGGACTCCGCCCCATTTCCCTTGTTGTTGTTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sung-Hyeok Hong et al.
Oncotarget, 6(9), 7151-7165 (2015-02-26)
Ewing sarcoma (ES) develops in bones or soft tissues of children and adolescents. The presence of bone metastases is one of the most adverse prognostic factors, yet the mechanisms governing their formation remain unclear. As a transcriptional target of EWS-FLI1
Min Hee Park et al.
The EMBO journal, 34(12), 1648-1660 (2015-04-29)
Many reports have revealed the importance of the sympathetic nervous system (SNS) in the control of the bone marrow environment. However, the specific role of neuropeptide Y (NPY) in this process has not been systematically studied. Here we show that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique