Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU034161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bst2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAATCTACTTCGCCGTCACAGCGAACAGCGTGGCCTGTAGAGACGGGTTGCGAGCGCAGGCTGAGTGCCGGAACACCACGCACCTGTTGCAGCGCCAGCTCACCCGCACCCAGGACAGTCTGCTGCAGGCCGAGACACAGGCAAACTCCTGCAACCTGACCGTGGTGACCCTTCAGGAGTCCCTGGAGAAGAAGGTGTCTCAAGCCCTGGAGCAGCAGGCCCGCATCAAGGAGCTTGAGAATGAAGTCACGAAGCTGAACCAGGAGCTGGAGAATCTGAGGATCCAAAAGGAGACTTCTAGCACAGTGCAGGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGTTCCTGCTCTTTTGAGGACTCATTAGTTGGCAGGTCACAGTTGTTTGAAGTCACTATGGGTCATAGTGACTCTGGAGAGGTCCTGGCAGCCCTGAGGATGTGGAAACCACTAGGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sebastian Giese et al.
PLoS pathogens, 10(7), e1004189-e1004189 (2014-07-06)
Bst-2/Tetherin inhibits the release of HIV by tethering newly formed virus particles to the plasma membrane of infected cells. Although the mechanisms of Tetherin-mediated restriction are increasingly well understood, the biological relevance of this restriction in the natural target cells
Kerstin Gnirß et al.
Journal of virology, 89(18), 9178-9188 (2015-06-26)
The expression of the antiviral host cell factor tetherin is induced by interferon and can inhibit the release of enveloped viruses from infected cells. The Vpu protein of HIV-1 antagonizes the antiviral activity of tetherin, and tetherin antagonists with Vpu-like
Jaraspim Narkpuk et al.
Biochemical and biophysical research communications, 450(4), 1469-1474 (2014-07-16)
While viral inhibition by tethering of budding virions to host cell membranes has been focused upon as one of the main functions of BST-2/tetherin, BST-2 is thought to possess other functions as well. Overexpression of BST-2 was found here to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique