Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU029651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt10a

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCTGGGTCTCAAGAATGGTTGTCCTCTTGGTGCCTGGCTTCTGCCGCTAGCGGATCTGAGCCAGGCAGCAAGCAGCAGCCTTGGCTCCTGAGAGAGGTGGTTGGCTCTTACAGCCCCGAGGGTCTACAATCACCAGACAGTCCAGATCTGATTGACATTCCTCCGCTCACCTCTGTAGGTTCCCCTCTTTCTGTTCCTAGCTCAGACAGCTGGGGGTGATAGTGGAGACTGTTCCACACCCTAGGACAGGTCACCAAAGCAGCCCAGCCTGGCATGCCTACCTCCTGTCATCTCTTCTTCCCTTCCCCAGGAGTGATAGGCAATGCACTGAAGCTGATGGGCACCGGGGAAGAAAACTAAAAGGCAGAAATGGCCGTCATCGGGCTGAAGTGACTCTAAGGGCTCCAGACCTCTGCTCCTGTCTTTCACTTAACAGATATTTATTTTTGCGCTCTCTTTGAGACA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jia Jing et al.
Adipocyte, 9(1), 401-414 (2020-07-24)
We discovered a unique expression pattern of two histone methyltransferases Suv39h1 and Suv39h2 during 3T3-L1 adipogenesis, both of which preferentially catalyse the formation of H3K9 dimethylation (H3K9me2) and further H3K9 trimethylation (H3K9me3), a transcriptional repressive mark. The expression of Suv39h1
Ren-Jun Hsu et al.
PloS one, 7(10), e47649-e47649 (2012-10-25)
Renal cell carcinoma (RCC) is a malignancy with poor prognosis. WNT/β-catenin signaling dysregulation, especially β-catenin overactivation and WNT antagonist silencing, is associated with RCC carcinogenesis and progression. However, the role of WNT ligands in RCC has not yet been determined.
Fujun Yu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2409-2420 (2016-11-11)
Wnt/β-catenin pathway is involved in liver fibrosis and microRNAs (miRNAs) are considered as key regulators of the activation of hepatic stellate cells (HSCs). A recent study showed the protective role of miR-378a-3p against cardiac fibrosis. However, whether miR-378a-3p suppresses Wnt/β-catenin

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique