Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU022681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sgk1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGGGCAGTTTTGGAAAGGTTCTTCTGGCTAGGCACAAGGCAGAAGAAGTATTCTATGCAGTCAAAGTTTTACAGAAGAAAGCCATCCTGAAGAAGAAAGAGGAGAAGCATATTATGTCAGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCATTCCAGACCGCTGACAAACTCTACTTTGTCCTGGACTACATTAATGGTGGAGAGCTGTTCTACCATCTCCAGAGGGAGCGCTGCTTCCTGGAACCACGGGCTCGATTCTACGCAGCTGAAATAGCCAGTGCCTTGGGCTATCTGCACTCCCTAAACATCGTTTATAGAGACTTAAAACCTGAGAATATTCTCCTAGACTCCCAGGGGCACATCGTCCTCACTGACTTTGGGCTCTGCAAAGAGAATATTGAGCATAACGGGACAACA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Takamitsu Miyayama et al.
Environmental toxicology and pharmacology, 38(2), 374-378 (2014-08-17)
In HK-2 cells exposed to cadmium chloride (CdCl2), the level of serum- and glucocorticoid-inducible kinase-1 (SGK1) protein is increased, but the levels of SGK2 and SGK3 proteins are not. Phosphorylation of SGK1 protein is also observed. Treatment with actinomycin D
Jian-An Bai et al.
World journal of gastroenterology, 21(20), 6180-6193 (2015-06-03)
To investigate the role of serum-and-glucocorticoid-inducible-kinase-1 (SGK1) in colitis and its potential pathological mechanisms. SGK1 expression in mucosal biopsies from patients with active Crohn's disease (CD) and normal controls was detected by immunohistochemistry. We established an acute colitis model in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique