Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU005041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fbxw7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGGAATGCTGAAACTGGAGAGTGTATACATACTTTATATGGGCACACTTCTACTGTACGGTGTATGCATCTCCATGAAAAAAGGGTTGTAAGCGGTTCTCGAGATGCCACTCTCAGGGTTTGGGATATTGAGACCGGCCAGTGTTTACACGTCCTGATGGGTCACGTAGCAGCGGTCCGCTGCGTTCAGTATGATGGCAGGAGGGTTGTTAGTGGAGCTTATGATTTTATGGTGAAGGTGTGGGATCCAGAGACTGAGACCTGTCTACACACGTTACAGGGACACACTAATAGAGTCTATTCATTACAGTTTGATGGCATCCATGTGGTGAGTGGATCTCTTGATACATCAATCCGAGTCTGGGATGTGGAGACAGGGAATTGTATTCACACGCTAACAGGACACC

Numéro d'accès Ensembl | souris

ENSMUSG00000028086

Numéro d'accès NCBI

NM_080428

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... FBXW7(50754) , Fbxw7(50754)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kangsheng Tu et al.
Molecular cancer, 13, 110-110 (2014-06-03)
The E3 ubiquitin ligase Fbxw7 functions as a general tumor suppressor by targeting several well-known oncoproteins for ubiquitination and proteasomal degradation. However, the clinical significance of Fbxw7 and the mechanisms involved in the anti-cancer effect of Fbxw7 in HCC are
Xiaoying Zhou et al.
Journal of experimental & clinical cancer research : CR, 34, 28-28 (2015-04-19)
Increasing evidence showed that miRNAs serve as modulators of human cancer, either as oncogene or tumor suppressors. Cisplatin resistance is the most common cause of chemotherapy failure in gastric cancer (GC). However, the roles of miRNAs in cisplatin resistance of
Junghui Koo et al.
The Journal of biological chemistry, 290(22), 14120-14129 (2015-04-22)
Rictor, an essential component of mTOR complex 2 (mTORC2), plays a pivotal role in regulating mTOR signaling and other biological functions. Posttranslational regulation of rictor (e.g. via degradation) and its underlying mechanism are largely undefined and thus are the focus

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique