Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU157831

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
303,00 $
50 μG
571,00 $

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
303,00 $
50 μG
571,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGCGTTCTGTCATCTCAGCAAAGAATGGAATCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGACCAGTGTTACTTTTGGAACCCCAGAGCGCCGCAAAGGGAGTCTTGCCGATGTGGTGGACACACTGAAACAGAAGAAGCTTGAGGAAATGACTCGGACTGAACAAGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACCAGTGAACTTCTTGGAGAAATTAAAGGTACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACCATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTACTGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shifeng Long et al.
Experimental and therapeutic medicine, 17(6), 4741-4747 (2019-05-21)
Increasing evidence has revealed that microRNAs (miRNAs) are closely associated with multiple myeloma (MM) pathogenesis and progression. Therefore, an in-depth understanding of the biological functions of miRNAs in MM may be helpful for the identification of promising therapeutic techniques for
W-W Xu et al.
European review for medical and pharmacological sciences, 24(8), 4070-4079 (2020-05-07)
Fragile fracture patients need to be treated with long-term fixation and the recovery process is slow. Several studies have shown that the fracture healing process is related to gene expression. We aimed to investigate the role of long chain non-coding
Aruna Marchetto et al.
Nature communications, 11(1), 2423-2423 (2020-05-18)
Ewing sarcoma (EwS) is an aggressive childhood cancer likely originating from mesenchymal stem cells or osteo-chondrogenic progenitors. It is characterized by fusion oncoproteins involving EWSR1 and variable members of the ETS-family of transcription factors (in 85% FLI1). EWSR1-FLI1 can induce

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique