Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU154291

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGAGCCAAGATACGTGGTTCTTTATGACGCAGAGCTAACCTTTGTTCGGCAGCTTGAAATTTACAGGGCGAGTAGGCCTGGGAAACCTCTGGTTTACTTTCTTATATACGGAGGTTCAACTGAGGAACAACGCTATCTCACTGCTTTGCGGAAAGAAAAGGAAGCTTTTGAAAAACTCATAAGGGAAAAAGCAAGCATGGTTGTCCCTGAAGAAAGAGAAGGCAGAGATGAAACAAACTTAGACCTAGTAAGAGGCACAGCATCTGCAGATGTTTCCACTGACACTCGGAAAGCCGGTGGCCAGGAACAGAATGGTACACAGCAAAGCATAGTTGTGGATATGCGTGAATTTCGAAGTGAGCTTCCATCTCTGATCCATCGTCGGGGCATTGACATTGAACCCGTGACTTTAGAGGTTGGAGATTACATCCTCACTCCAGAAATGTGCGTGGAGCGCAAGAGTATCAGTGATTTAATCGGCTCTTTAAATAACGGCCGCCTCTACAGCCAGTGCATCTCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Barbara Steurer et al.
Nucleic acids research, 47(7), 3536-3549 (2019-01-31)
UV light induces cyclobutane pyrimidine dimers (CPDs) and pyrimidine-pyrimidone (6-4) photoproducts (6-4PPs), which can result in carcinogenesis and aging, if not properly repaired by nucleotide excision repair (NER). Assays to determine DNA damage load and repair rates are invaluable tools
Katia A Mesquita et al.
Gynecologic oncology, 153(2), 416-424 (2019-02-25)
PARP inhibitor maintenance therapy in platinum sensitive sporadic ovarian cancers improves progression free survival. However, biomarker for synthetic lethality in platinum sensitive sporadic disease is yet to be defined. ERCC1-XPF heterodimer is a key player in nucleotide excision repair (NER)
Haiqing Fu et al.
Nature communications, 6, 6746-6746 (2015-04-17)
The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique