Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU153321

Sigma-Aldrich

MISSION® esiRNA

targeting human CCND1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaohong Jiang et al.
Gene therapy, 27(12), 557-566 (2020-06-07)
LncRNAs are reported to participate in the progression of various diseases including diabetic nephropathy. Currently, we reported that SNHG16 was obviously upregulated in db/db mice and high glucose-treated mice mesangial cells. Then, functional experiments showed that SNHG16 silencing significantly inhibited
Dexin Yin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(4), 1499-1511 (2018-09-12)
Recent studies have suggested that several lncRNAs contribute to the angiogenic function of endothelial cells. Herein, we set out to reveal whether lncRNA UCA1 has functions in endothelial angiogenesis. The expression levels of lncRNA UCA1, miR-195 and CCND1 in human
Chuanyong Wu et al.
Journal of Cancer, 11(7), 1959-1967 (2020-03-21)
Accumulating evidences showed that aberrantly expressed long noncoding RNAs (lncRNAs) have critical roles in many cancers. However, the expression and roles of a poorly studied lncRNA PCNA-AS1 in non-small-cell lung cancer (NSCLC) remain unknown. In this study, we investigated the
Mingming Wang et al.
Journal of cellular physiology, 235(2), 1588-1600 (2019-07-17)
Prostate cancer (PCa) is one of the major health problems of the aging male. The roles of dysregulated microRNAs in PCa remain unclear. In this study, we mined the public published data and found that miR-487a-3p was significantly downregulated in
Ningning Li et al.
Oncogene, 37(31), 4313-4333 (2018-05-04)
To identify biomarkers for glioma growth, invasion and progression, we used a candidate gene approach in mouse models with two complementary brain tumour phenotypes, developing either slow-growing, diffusely infiltrating gliomas or highly proliferative, non-invasive primitive neural tumours. In a microRNA

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique