Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU151811

Sigma-Aldrich

MISSION® esiRNA

targeting human PIK3R1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGAGGCAAGGTTATATGCACTTTCTCATGATTTACAGAGAAGTGAATAACTGCAAAGTGAAGTTGCTTCTTCTACTTCAGTCTTCTCTCACTTTGATTTGCTAGTTGTTATCAATTAATGACAATTACAAACCTACTGTATCTCTAATACAGTGTGACTGGTCAGGTATTTCAGTTCTTAGGAAGGAAGTGCCAAGTTTGTTTTTGGGTTCCTGGAACAGCGCTCACCTTTGTTTAGAACACTGGTTTAAAGGGATAATCATCTCTGTCACATTAGACTATCCATCATGACCAGCAAATACTCATTTTAGGAAAAAAAAAAGCATGATCTGAAAAATACTTTTGGTGGTATGTTGGTTACCCTCCTAGCTTTCCATTTGGTTTAGAACATAAAGCAAATAGACACAGTCATACTGTCACTGCTCTGGACTGTGTGGAGCTCGCTAAAGTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xinran Li et al.
Nature communications, 10(1), 716-716 (2019-02-14)
Copy number loss of PIK3R1 (p85α) most commonly occurs in ovarian cancer among all cancer types. Here we report that ovarian cancer cells manifest a spectrum of tumorigenic phenotypes upon knockdown of PIK3R1. PIK3R1 loss activates AKT and p110-independent JAK2/STAT3
Reem Ali et al.
Cells, 8(10) (2019-10-23)
Ataxia-telegiectasia mutated (ATM), phosphatase and tensin homolog (PTEN), and p85α are key tumour suppressors. Whether ATM regulates PTEN expression and influence platinum sensitivity is unknown. We generated ATM knockdowns (KD) and CRISPR knock outs (KO) in glioblastoma (LN18, LN229) and
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed
Zhenyou Zou et al.
Journal of drug targeting, 22(9), 839-848 (2014-07-16)
Multi-drug resistance (MDR) cancer is an intractable problem. Over-expression of drug efflux transporters such as ABCB1, ABCC1 and ABCG2 contributes to it, by which they pump drugs out of cells, and result in the decrease in the efficacy of chemotherapy.
Xue Bai et al.
Oncology reports, 33(6), 3085-3092 (2015-05-13)
Cervical cancer is the second most common women carcinoma worldwide and the fourth leading cause of cancer-associated mortality in women. Butein, a bioactive flavonoid isolated from numerous native plants, has been shown to induce apoptosis and inhibits migration and invasion

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique