Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU150021

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCGGTGATGAGCTACAGTGCCAAATTTGCTTCCTGTTTCTATGGCCCTTTCCGGGATGCAGCTAAGTCAAGCCCAGCTTTTGGGGACCGCCGCTGCTACCAGCTGCCCCCTGGAGCACGAGGCCTGGCTCTCCGAGCTGTGGACCGGGATGTACGGGAAGGAGCTGACATGCTCATGGTGAAGCCGGGAATGCCCTACCTGGACATCGTGCGGGAGGTAAAGGACAAGCACCCTGACCTCCCTCTCGCCGTGTACCACGTCTCTGGAGAGTTTGCCATGCTGTGGCATGGAGCCCAGGCCGGGGCATTTGATCTCAAGGCTGCCGTACTGGAGGCCATGACTGCCTTCCGCAGAGCAGGTGCTGACATCATCATCACCTACTACACACCGCAGCTGCTGCAGTGGCTGAAGGAGGAATGATGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhou Zheng et al.
Fish & shellfish immunology, 81, 168-175 (2018-07-17)
Shrimps, which mainly rely on their innate immune system to response to infectious pathogens, have clottable proteins as an important component of this system. While transglutaminases (TGase) are found in Litopenaeus vannamei and constitute part of the coagulation system, the
Guicai Gao et al.
Developmental and comparative immunology, 98, 99-107 (2019-05-06)
White spot syndrome, which is caused by white spot syndrome virus (WSSV), is a highly contagious disease of penaeid shrimp. However, there is currently incomplete understanding of the infection mechanism and pathogenesis of WSSV. In this study, a novel gene
Gang Liu et al.
Nature communications, 11(1), 6310-6310 (2020-12-11)
Heme biosynthesis and iron-sulfur cluster (ISC) biogenesis are two major mammalian metabolic pathways that require iron. It has long been known that these two pathways interconnect, but the previously described interactions do not fully explain why heme biosynthesis depends on

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique