Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU144451

Sigma-Aldrich

MISSION® esiRNA

targeting human NUPR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAGAGAGGCAGGGAAGACAAGCCAGGCACGATGGCCACCTTCCCACCAGCAACCAGCGCCCCCCAGCAGCCCCCAGGCCCGGAGGACGAGGACTCCAGCCTGGATGAATCTGACCTCTATAGCCTGGCCCATTCCTACCTCGGAGGTGGAGGCCGGAAAGGTCGCACCAAGAGAGAAGCTGCTGCCAACACCAACCGCCCCAGCCCTGGCGGGCACGAGAGGAAACTGGTGACCAAGCTGCAGAATTCAGAGAGGAAGAAGCGAGGGGCACGGCGCTGAGACAGAGCTGGAGATGAGGCCAGACCATGGACACTACACCCAGCAATAGAGACGGGACTGCGGAGGAAGGAGGACCCAGGACAGGATCCAGGCCGGCTTGCCACACCCCCCACCCCTAGGACTTATTCCCGCTGACTGAGTCTCTGAGGGGCTACCAGGAAAGCGCCTCCAACCCTAGCAAAAGTGCAAGATGGGGAGTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ki-Sun Kim et al.
Anatomy & cell biology, 45(1), 17-25 (2012-04-27)
Nuclear protein-1 (NUPR1) is a small nuclear protein that is responsive to various stress stimuli. Although NUPR1 has been associated with cancer development, its expression and roles in cholangiocarcinoma have not yet been described. In the present study, we found
Patricia M Schnepp et al.
Molecular cancer research : MCR, 18(9), 1290-1301 (2020-06-10)
The majority of patients with prostate cancer treated with docetaxel develop resistance to it. To better understand the mechanism behind the acquisition of resistance, we conducted single-cell RNA-sequencing (scRNA-seq) of docetaxel-sensitive and -resistant variants of DU145 and PC3 prostate cancer
Anthony Murphy et al.
Oncology reports, 45(4) (2021-03-03)
Nickel (Ni) is carcinogenic to humans, and causes cancers of the lung, nasal cavity, and paranasal sinuses. The primary mechanisms of Ni‑mediated carcinogenesis involve the epigenetic reprogramming of cells and the ability for Ni to mimic hypoxia. However, the exact
Yanchao Mu et al.
Autophagy, 14(4), 654-670 (2017-11-14)
In the advanced stages of cancer, autophagy is thought to promote tumor progression through its ability to mitigate various cellular stresses. However, the details of how autophagy is homeostatically regulated in such tumors are unknown. Here, we report that NUPR1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique