Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU140721

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGAAGGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jun Tang et al.
Neuropharmacology, 119, 157-169 (2017-02-06)
Microglia play dual roles after germinal matrix hemorrhage, and the neurotrophic phenotype maybe neuroprotective. However, the phenotype transformation and the way by which neuron-microglia dialogue remain unclear. We raise the hypothesis that a cannabinoid receptor2 agonist (JWH133) accelerates the CX3CR1
Lisa Rooper et al.
Journal of ovarian research, 6(1), 57-57 (2013-08-21)
The goal of this study was to determine a predominant cell type expressing fractalkine receptor (CX3CR1) in mature ovarian teratomas and to establish functional significance of its expression in cell differentiation. Specimens of ovarian teratoma and human fetal tissues were
Yoshimi Enose-Akahata et al.
Retrovirology, 9, 16-16 (2012-02-18)
The activation of mononuclear phagocytes (MPs), including monocytes, macrophages and dendritic cells, contributes to central nervous system inflammation in various neurological diseases. In HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP), MPs are reservoirs of HTLV-I, and induce proinflammatory cytokines and excess T
Sheng-Mou Hou et al.
Arthritis research & therapy, 19(1), 282-282 (2017-12-23)
Osteoarthritis (OA) is a degenerative joint disease that affects the cartilage, synovium, and subchondral bone and is the leading cause of disability in older populations. Specific diagnostic biomarkers are lacking; hence, treatment options for OA are limited. Synovial inflammation is
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique