Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU139771

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGCTTTCCATCCACTCACCTTACCCCATAGCATCTTGCGGCCCAGAAACCAGAGCCATTTGTCTCAGACCCTAAATCAATAATCACAAACCCCAAAACGGGAGAGAGCAGTGAAAACATGCAGGGCTGTGGACGGGGGAAGGGTTGTGGCGGGTGTTCTGAGGCTGAGAGGACACCTATATGCGTATTTCCTCTACACACATCACCCCCCTTCTATAATCTTAAGCCATGACTAGCCTGGTGGCGTGTTAGTTTCTGCCCAGTTCTACCCCCTCATGTGCTTCTTCTGAATACTGAATGTGACTGTTTGAAAGCTGGTAGAATTCATCCCTCTTACTGTAGATAACACTGCAAATCTTGGAATTTTGTTTTTTGCTGTTTCCAGATGTATCTATAAATATCTATACATTATATGTGTGTGTGTGTGTGTGTGTGTGTGTGTACATCGGGTCCTCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hua Cheng et al.
Shock (Augusta, Ga.), 54(6), 802-809 (2020-03-19)
Myocardial ischemia reperfusion (IR) injury is a serious issue in the treatment of myocardial infarction. MiR-433 is upregulated in myocardial IR injury, but its specific effects remain unclear. In this study, we explored the effect and mechanism of miR-433 in
Yuan Xing et al.
Basic research in cardiology, 111(2), 11-11 (2016-01-19)
N-myc downstream-regulated gene 4 (NDRG4) is expressed weakly in heart and has been reported to modulate cardiac development and QT interval duration, but the role of NDRG4 in myocardial ischemia/reperfusion (I/R) injury remains unknown. In the present study, we analyzed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique